I might be missing something else as I am only entering information for the Hostname, SSID, and password. However, there is nothing else on my network and I get the same results using my mobile hotspot. Hi Max, I'm not quite sure what you mean or what I should be looking for. You may also want to watch the project's YouTube video. So without taking up any more of your time, let's prepare to make this CCTV cam! ![]() The Security camera comes loaded with even more features which will be mentioned below. MJPEG video files to an SD card when something/someone moves in front of the camera triggering it to start recording. The camera with its current code can save recorded. With this security camera, you can log into the web server by typing in its unique IP address into your web browser, and view what the camera sees along with being able to change things around on the side control panels. This project will be based on the $9 ESP32-CAM AI thinker WiFi camera module, in my opinion, one of the best and cheapest camera development boards out there. In this instructable, you will learn how to make your own DIY Surveillance camera for cheap, under $15 depending on the supplies you may already have. Hey, fellow makers! I welcome you to my first instructable about this Homemade wireless ESP32-CAM WiFi Surveillance Camera which we're going to make today to monitor our home, environment, or perhaps to even spy on someone )Įven though decent commercial WiFi Security Cameras aren't all super expensive, they still cost quite a bit especially when you're wanting to buy several of them for your home security.
0 Comments
Shop fitting and retail equipment: EPOS and POS terminals, bar code/barcode scanners, card readers, weighing systems, door entry and HVAC systems, bar code readers. Using your Network and our Free Remote COM Ports software application you may easily connect to the following remote devices: Network configuration and management equipment: routers, switches, multiplexers, hubs, firewalls, load balancers, console ports, wireless LAN equipment Diagnostic, controlling and measuring tools: digital multimeters (multitesters), oscilloscopes, manometers, sensors Telecommunication equipment: Fax-Modems, mini-ATS, PBX, Cell Phones, GSM mobile phones, GPS, satellite phones, low-speed satellite modems and other satellite based transceiver devices. Our remote serial ports technology may be successfully used with following RS-232, RS-422, RS-485 physical devices, hardware equipment and peripherals:ĭial-up modems, industrial equipment and automation systems, PLCs, VFDs, servo drives, CNC RS-232 controllers, terminals, printers, RS-232, RS-422 and RS-485 test instruments, serial device servers, NPort servers, multiport serial boards, laboratory automation equipment, scientific instruments, serial to fiber converters, RS-232 to RS-422/485 converters. GUI and Command-line Configuration Utilities.Created local virtual serial port will behave exactly as shared serial port on the remote side, making your hardware serial device connected to remote computer available for access from your local workstation exactly the same way as it was actually connected to the existing local serial port. ![]() No administrative privileges, no additional network configuration is required, just copy/paste and use it. In most cases, no specific network configuration, like IP address or network name needs to be accounted for. You do not need to care what network protocols (TCP/IP, UDP/IP, etc.), Ethernet standards or the type of underlying connection (LAN, WAN or Internet) are used for serial port redirection. Then connect it using Remote Serial Ports Client running on your PC. No matter what serial device is connected to the remote computer, you may treat it as a real serial hardware device connected to your local physical port.ĭeploy Remote Serial Ports Server using simple copy/paste to the remote computer to share com port over network. All data exchanged between the remote computer and device is transferred to the local virtual port. ![]() ![]() Virtual copy of a shared remote serial port is created on a local machine and all serial port features are replicated on the local copy. See all Free Remote Serial Ports screenshotsįree Remote Serial Ports is a COM ports redirecting freeware utility which allows you to share any serial port and access it remotely using LAN or Internet connection. For example, you can use Truseq Read 1 at the left hand side, and Nextera Read 2 at the right hand side. In addition, you can also mix different types of adaptors due to the reaons mentioned in the "Library sequencing" section below. All the commercial kits you buy for the library preparation do EXACTLY that, no matter where your buy them, no matter what you want to sequence. Basically, the nature of an Illumina library preparation is the process of adding those coloured adaptor seuqences to both sides of the DNA of your interest, which is the "-insert-" bit in the above examples. If you are interested, you can check the Illumina adapter sequences document for full details. There are some other adaptors that can be used, but they either become obsolete or not used usually. Illumina P5 i5 Next era Read 1 Next era Read 2 i7 Illumina P7 Illumina P5 i5 Truseq Read 1 Truseq Read 2 i7 Illumina P7 Nextera Dual Index Library:ĥ'- AATGATACGGCGACCACCGAGATCTACAC NNNNNNNN TCGTCGGCAGCGTC AGATGTGTATAAGAGACAG-insert- CTGTCTCTTATACACATCT CCGAGCCCACGAGAC NNNNNNNN ATCTCGTATGCCGTCTTCTGCTTG -3'ģ'- TTACTATGCCGCTGGTGGCTCTAGATGTG NNNNNNNN AGCAGCCGTCGCAG TCTACACATATTCTCTGTC-insert- GACAGAGAATATGTGTAGA GGCTCGGGTGCTCTG NNNNNNNN TAGAGCATACGGCAGAAGACGAAC -5' Illumina P5 Truseq Read 1 Truseq Read 2 i7 Illumina P7 Truseq Dual Index Library:ĥ'- AATGATACGGCGACCACCGAGATCTACAC NNNNNNNN ACACTCTTTCCCTACACGACGCTCTTCCGATCT-insert- AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC NNNNNNNN ATCTCGTATGCCGTCTTCTGCTTG -3'ģ'- TTACTATGCCGCTGGTGGCTCTAGATGTG NNNNNNNN TGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA-insert- TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG NNNNNNNN TAGAGCATACGGCAGAAGACGAAC -5' The following three (actually two main types to be honest) are the most popular ones:ĥ'- AATGATACGGCGACCACCGAGATCTACAC TCTTTCCCTACACGACGCTCTTCCGATCT-insert- AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC NNNNNNNN ATCTCGTATGCCGTCTTCTGCTTG -3'ģ'- TTACTATGCCGCTGGTGGCTCTAGATGTG AGAAAGGGATGTGCTGCGAGAAGGCTAGA-insert- TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG NNNNNNNN TAGAGCATACGGCAGAAGACGAAC -5' The adaptors are designed by scientists, and there are a few popular adaptor sequences that are used in the NGS field. Any SBS method requires the presence of adaptors, which are short double-stranded DNA oligos whose sequences are known to us. The nature of Illumina sequencing is still sequencing by synthesis (SBS). (3) Cluster regeneration, add Read 2 sequencing primer to sequence the second read (top strand as template, sequence cDNA):ĥ'- AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGG AAGCAGTGGTATCAACGCAGAGTACGT NNNNNNNNNNNN NNNNNNNN(dT)XXX.Illumina sequencing About Illumina sequencing libraries (2) Add i7 index sequencing primer to sequence the i7 index (bottom strand as template):ĥ'- CTGTCTCTTATACACATCT CCGAGCCCACGAGAC-> |-5'- TTTTTTTT AAGCAGTGGTATCAACGCAGAGTACGT (dT)XXX.XXX CTGTCTCTTATACACATCTĪAAAAAAA TTCGTCACCATAGTTGCGTCTCATGCA (pA)XXX.XXXXXXXXXXXX GACAGAGAATATGTGTAGA GGCTCGGGTGCTCTG -5'ģ'- TTACTATGCCGCTGGTGGCTCTAGATGTGCGGACAGGCGCC TTCGTCACCATAGTTGCGTCTCATGCA NNNNNNNNNNNN NNNNNNNN(pA)XXX.XXX GACAGAGAATATGTGTAGA GGCTCGGGTGCTCTGNNNNNNNN TAGAGCATACGGCAGAAGACGAAC -5' TTCGTCACCATAGTTGCGTCTCACTTACCCXXXXX.XXXXX(dT) TGCA TGAGACGCAACTATGGTGACGAATTTTTTTT -5'-| Step-by-step library generation (1) mRNA capture using Beads-oligo-dT in the droplets:ĥ'- AAGCAGTGGTATCAACGCAGAGTGAATGGGXXXXX.XXXXX(pA) ACGT ACTCTGCGTTGATACCACTGCTTAAAAAAAA I7 index sequencing primer: 5'- CTGTCTCTTATACACATCT CCGAGCCCACGAGAC -3' Read 2 sequencing primer: 5'- GTCTCGTGGGCTCGG AGATGTGTATAAGAGACAG -3' Read 1 sequencing primer (seqB): 5'- GCCTGTCCGCGG AAGCAGTGGTATCAACGCAGAGTAC -3' Read 1 sequencing primer (seqA): 5'- GCCTGTCCGCGG AAGCAGTGGTATCAACGCAGAGTACGT -3' Library PCR primer 2 (this is basically Nextera N7xx): 5'- CAAGCAGAAGACGGCATACGAGAT GTCTCGTGGGCTCGG -3' Library PCR primer 1: 5'- AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGG AAGCAGTGGTATCAACGCAGAGTAC -3' Illumina P7 adapter: 5'- CAAGCAGAAGACGGCATACGAGAT -3' Illumina P5 adapter: 5'- AATGATACGGCGACCACCGAGATCTACAC -3' Nextera N7xx primer entry point (s7): 5'- GTCTCGTGGGCTCGG -3' ![]() Nextera N/S5xx primer entry point (s5): 5'- TCGTCGGCAGCGTC -3' Nextera Tn5 binding site (19-bp Mosaic End (ME)): 5'- AGATGTGTATAAGAGACAG -3' Template Switching Oligo (TSO): 5'- AAGCAGTGGTATCAACGCAGAGTGAATrGrGrG -3' Seq-Well used exact the same oligo design with Drop-seq with Beads-oligo-dT-seqB, which was published in Nature Methods 14, 395–398 (2017).īeads-oligo-dT-seqA: |-5'- TTTTTTT AAGCAGTGGTATCAACGCAGAGTACGT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT -3'īeads-oligo-dT-seqB: |-5'- TTTTTTT AAGCAGTGGTATCAACGCAGAGTAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT -3' Here, Beads-oligo-dT-seqA was used as demonstration. In the original pulication in Cell 161, 1202-1214 (2015), there are two batches of beads, with only two base pairs difference. ![]() If you have specific questions concerning contrast, please contact your local Radia imaging center and ask to speak to a CT technologist. If your exam requires iodinated IV contrast, you will be asked to sign a consent form which explains the need for contrast, the techniques, the alternatives, and the risks. If you have experienced an allergic reaction to IV contrast in the past please notify your physician so alternatives can be discussed. ![]() The IV contrast Radia uses is an iodine-based agent. The most common effects of IV contrast include a "warm, tingly" feeling at the injection site and a metallic taste in the back of the mouth. Both of these are normal responses to the contrast agent. Iodine is considered to be safe delivered intravenously, but some people experience an allergic reaction to the material. If your exam requires oral contrast, you will be asked to arrive at Radia 90 minutes before your exam to begin taking the contrast orally. Minor cramping or constipation are known possible side effects, but many people experience no discomfort from taking it. Oral contrast, when mixed with water, may also be delivered rectally in order to maximize the amount of the body that can be seen. Hospital affiliations include Virginia Mason Medical Center. This provider currently accepts 30 insurance plans. The oral contrast Radia provides comes bottled and pre-mixed in a choice of flavors. Oral contrast is considered to be quite safe and will pass out of the system within a day. In Kirkland Washington, Evergreen Radia LLC has 63 members working at 2 different practice locations. Justin Siegal, MD, is a Diagnostic Radiology specialist practicing in Seattle, WA with 23 years of experience. ![]() There are different types of contrast agents which, depending on the type of exam, may be injected intravenously, delivered rectally, or you may be asked to take it orally over a period of time.Īt Radia, contrast is used in two different ways: A contrast agent is used to emphasize specific parts of the body such as vessels, organs, and tissues, so they are easier for the radiologist to see. New hires will be required to present written proof of COVID-19 vaccination or a written request for an Exemption within 30 days of hire.Some CT exams require a contrast agent to be given to the patient before the exam begins. Our team of more than 200 board-certified radiologists, with specialty training in everything from Mammography to Neuroradiology and Musculoskeletal to Interventional, provide more than 50 hospital and specialty clinic partners with on-site radiology coverage and interpretations.ĬOVID Requirements: To protect physicians, employees, and patients of Radia from contracting COVID-19 and to help prevent the spread of COVID-19, Radia requires that all Health Care Setting Workers receive a COVID-19 vaccination, subject to the exemptions. Radia is one of the largest and most progressive radiology groups in the nation. Some on-call coverage at our Redmond location is requiredĭemonstrates a professional demeanor in appearance and behavior in all work-related interactionsĮvergreen Radia is an Imaging Center of Radia. Evergreen health diagnostic imaging kirkland WebRadias Mission: Deliver the highest quality patient centered healthcare to the communities we serve through. Washington State Radiologic Technologist - Diagnostic license required (Washington State X-ray license, ARRT)Īdvanced registry in MRI required within 6 months of hireĬurrent certification in Healthcare Provider BLS/CPRġ year experience as a successful MRI tech preferred Satisfactory completion of a formal radiologic technology program or other compatible course of study ![]() Something like this for elves could be used to offset the advantages that come from being closer to the supernatural world. Their actions (particularly harming humans or using supernatural powers) are not a natural part of creation, sending out a "disturbance" that can be felt by other supernatural beings. However, the angels are restricted in what they can do by their divine nature, with a ranking that indicates how close to the divine they are (with possibly the strictest restriction, the inability to lie at all, imposed on the Most Holy seraphim) and mechanical penalties if they break the rules. So how to put this into a game? One of my favourite settings is In Nomine, where you can indeed play a literal angel, or a human. This is one reason the hobbits tend to be the good ones - a hobbit is more likely to be greedy for cakes or proud of his carpentry skills that to want to conquer the world or create the most powerful magical item in history. Being closer to the divine, while still having human-like flaws (pride, greed, envy, etc.) is not a good position to be in. Tbh it's also corrupting in Middle Earth, but in a less obvious way, as elven might tends to be drawn to great deeds which often go very wrong indeed (e.g. ![]() in fact, most Warhammer elves have BIG problems since proximity to the supernatural is inherently corrupting in WH). ![]() Moorcock's Melniboneans or Warhammer's Dark Elves. Of course, it's easy to subvert this (e.g. Relegating elves to NPCs is also a bit unsatisfying (especially as it's heading towards Mary Sue or GMPC territory). This has, of course, advantages and disadvantages, but the advantages tend to be more immediate (better at magic, immunity to disease, generally prettier) so they don't translate well into game systems due to imbalance. This is much more how Tolkien envisions them. One thing that's rare to see in D&D-esque worlds is the Tolkienesque elves who are genuinely closer to the divine (or the magical, if you prefer) - halfway between human and angel. It helps distinguish elements on a page, contributes to visual hierarchy, draws attention to key elements, and creates an aesthetically pleasing user experience. Color theory in UI design guides designers to create visually engaging interfaces that users find intuitive and easy to navigate. Furthermore, understanding color temperature (whether you use cool, warm, or neutral colors) can help designers align the color scheme with the message they want to convey.īut why is color theory vital for UI design?Ĭolor is a powerful communication tool in the digital space. The color schemes must align with the design's goal and the brand's personality. Learn about color theory keywords and their significance. Square: A variant of tetradic, this scheme finds four colors evenly spaced on the color wheel. Tetradic: This involves using four colors that form two sets of complementary pairs with one color dominating. Triadic: The Triadic scheme uses three equally distant colors on the color wheel. Split-Complementary: This scheme uses colors from either side of your complementary color pair to soften the contrast. Monochromatic: The monochromatic scheme involves taking one hue and creating other design elements from shades and tints.Īnalogous: Analogous colors involve using three colors next to each other on the color wheel, such as blue, blue-violet, and violet.Ĭomplementary: Designers use 'opposite color' pairs like blue and yellow to maximize contrast here. You can utilize several main color schemes: A color scheme is a set of colors that work well together visually. ![]() One approach to practically applying color theory lies in creating color schemes vital for design harmony. So, how does color theory in UI design play out in practice? It empowers designers to create harmonious, meaningful web and mobile app designs that enhance the user experience. Understanding and applying these elements are crucial in UI design. Lightness is how much light the color has.ĥ0% is in the middle, not too dark or light. Now, let's break down the critical components of color, i.e., HSL (hue, saturation, and lightness). ![]() Chevreul’s theory was very influential in the French Impressionist movement. Chevreul devised a simple yet effective rule to explain the visual effect of simultaneous contrast in all kinds of situations: when two colors are seen side by side or one after another, each color seems to change in hue and brightness as though it had been mixed with the opposite color from the color wheel. Michel-Eugène Chevreul, a French chemist, then came up with Principles of Color Harmony (1839), which help us understand and use colors today. Conceived by Sir Isaac Newton in 1666 with the invention of the color wheel, color theory has expanded beyond identifying primary, secondary, and tertiary UI design colors. Basics of Color Theory in UI DesignĬolor theory is a framework that underpins how we understand and use color. Learn how to use color to prevent confusion and help your users. © Interaction Design Foundation, CC BY-SA 4.0 In screen design, we use the color model, with red, green, and blue as primary colors. When it comes to applying color to an interface, RGB is what we use. RGB, CMYK, and Lab are all examples of such color systems. You can create a color theme based on your chosen material design color system. It's like a color toolbox where you can mix a few selected colors to create shades and hues. Here’s what a color system means - A color system is a collection of colors chosen from a particular visual range. The palette provides specific colors, while the system offers a structured way to organize the colors. Difference between a Color System and a Color PaletteĪ color palette and a color system work hand-in-hand. ![]() A well-curated color palette enhances the user experience as it guides users seamlessly through the interface. The colors in this palette work together to form a cohesive visual experience.Ī UI color palette is essential for establishing visual harmony, defining brand identity, and influencing user behavior. It holds a specific set of colors for use across an application or website. Understanding UI Color PalettesĪ UI color palette is a collection of colors used in designing a user interface. We’ll explore the best practices, essential tips, and innovative tricks that will help you navigate the landscape of UI design. So, let’s understand all about the UI Color Palette. It’s crucial to stay updated with the latest shifts in design as trends continuously evolve. Color creates an impactful dialogue between the design and its audience, whether you want to spark interest, convey a message, or stir emotions. It enhances aesthetics, shapes the user experience, and influences decision-making. When it comes to user interface (UI) design, color plays an important role. ![]() In 1973, Jim Bowery released Spasim for PLATO - a 32-player space shooter - which is regarded as the first example of a 3D multiplayer game. PLATO (Programmed Logic for Automatic Teaching Operation), was one of the first generalized computer-based teaching systems, originally built by the University of Illinois and later taken over by Control Data (CDC), who built the machines on which the system ran.Īccording to usage logs from the PLATO system, users spent about 300,000 hours playing Empire between 19. The first example of players competing on separate screens came in 1973 with “Empire” - a strategic turn-based game for up to eight players - which was created for the PLATO network system. At this point, multiplayer gaming was limited to players competing on the same screen. The nature of the games sparked competition among players, who could record their high scores with their initials and were determined to mark their space at the top of the list. started to install video games to capitalize on the hot new craze. The Roots Of Multiplayer Gaming As We Know Itĭuring the late 1970s, a number of chain restaurants around the U.S. Tech-heads realized they were onto a big thing between 19, more than 15 companies began to develop video games for the ever-expanding market. The nature of the games sparked competition among players, who could record their high scores … and were determined to mark their space at the top of the list.Ītari not only developed their games in-house, they also created a whole new industry around the “arcade,” and in 1973, retailing at $1,095, Atari began to sell the first real electronic video game Pong, and arcade machines began emerging in bars, bowling alleys and shopping malls around the world. In 1972, Atari (founded by Nolan Bushnell, the godfather of gaming) became the first gaming company to really set the benchmark for a large-scale gaming community. ![]() Sega and Taito were the first companies to pique the public’s interest in arcade gaming when they released the electro-mechanical games Periscope and Crown Special Soccer in 19. However mismanaged it might have been, this was the birth of the digital gaming we know today. ![]() Poor sales were blamed on mismanaged in-store marketing campaigns and the fact that home gaming was a relatively alien concept to the average American at this time. The “Brown Box” was licensed to Magnavox, which released the system as the Magnavox Odyssey in 1972. It preceded Atari by a few months, which is often mistakenly thought of as the first games console.īetween August 19, when the Magnavox was discontinued, around 300,000 consoles were sold. Using advanced technology for this time, added accessories included a lightgun for a target shooting game, and a special attachment used for a golf putting game.Īccording to the National Museum of American History, Baer recalled, “The minute we played ping-pong, we knew we had a product. The “Brown Box” could be programmed to play a variety of games, including ping pong, checkers and four sports games. The “Brown Box” was a vacuum tube-circuit that could be connected to a television set and allowed two users to control cubes that chased each other on the screen. However, the first game system designed for commercial home use did not emerge until nearly three decades later, when Ralph Baer and his team released his prototype, the “Brown Box,” in 1967. The game, based on the ancient mathematical game of Nim, was played by about 50,000 people during the six months it was on display, with the computer reportedly winning more than 90 percent of the games. Edward Uhler Condon at the New York World’s Fair in 1940. The first recognized example of a game machine was unveiled by Dr. Indeed, gaming has become so integrated with modern popular culture that now even grandmas know what Angry Birds is, and more than 42 percent of Americans are gamers and four out of five U.S. The mobile technology boom in recent years has revolutionized the industry and opened the doors to a new generation of gamers. Since its commercial birth in the 1950s as a technological oddity at a science fair, gaming has blossomed into one of the most profitable entertainment industries in the world. Riad Chikhani is co-founder and CEO of gaming social network Gamurs. ![]() With Xodo, you can easily access PDF files from documents or web pages, create new PDFs, and organize them in folders. Any PDF expert or manager can use PDF Reader to annotate, edit, combine, convert, encrypt, scan, and sign PDF documents, wherever you are at school, work, home, or on the go. PDF Reader is a powerful PDF solution for your iPhone, iPad, and Mac. Its expert features allow you to view, annotate, combine, organize. Xodo PDF Reader and Editor offer a multi-tab document viewer, bookmarks, and a night mode for low-light reading. Download PDF Reader - Edit Adobe PDF and enjoy it on your iPhone, iPad, and iPod touch. PDF Reader also lets you convert them to other file formats to make it convenient for future editing. Join Our Telegram Channel We gather all these tests and Materials with. PDF Reader gives you the ability to create and combine multiple PDF files so you can easily save all homework from the particular class or subject as one PDF file. Its expert features allow you to view, annotate. A series of useful 'How-to' guides will help you work with PDF documents smarter and faster. Easily combine two or more PDFs into one unified PDF document with the best PDF merger on your Mac and Windows devices. Create PDF booklets, impose (nup pages), combine PDF files and add watermarks. How to Merge and Combine PDFs into a Single Document. Any PDF expert or manager can use PDF Reader to annotate, edit, combine, convert, encrypt, scan, and sign PDF documents, wherever you are at school, work, home, or on the go. PDF Reader is a document productivity solution for your business and daily life. de 2021 JNTUK R16 3-1 Management Science Material/Notes PDF. Covering all the essentials and more, Kdan PDF Reader is the worlds leading PDF editor on the market. Kdan PDF Reader vs.Get the Adobe Acrobat Reader mobile app, the worlds most. ![]() Bob Seger & the Silver Bullet Band - Night Moves (1976) album releases & credits at Discogs.Bob Seger & the Silver Bullet Band - Night Moves (1976) album review by Stephen Thomas Erlewine, credits & releases at.Recording Industry Association of America. ^ "American album certifications – Bob Seger – Night Moves".^ "Canadian album certifications – Bob Seger – Night Moves".^ "Top Billboard 200 Albums – Year-End 1977".^ "Bob Seger Chart History ( Billboard 200)".Archived from the original (PDF) on Octo. ^ a b c Bob Seger & the Silver Bullet Band - Night Moves (1976) album releases & credits at.^ "Bob Seger & the Silver Bullet Band - Night Moves (1976) album credits". Bob Seger & The Silver Bullet Band - Night Moves (Official Video).Archived from the original on January 7, 2008. ^ a b Rachlis, Kit (January 13, 1977).^ "Gold & Platinum Searchable Database" (PHP).Christgau's Record Guide: Rock Albums of the Seventies. : CS1 maint: others in cite AV media (notes) ( link) ^ a b c d e f g h Night Moves (CD Liner)."Bob Seger & the Silver Bullet Band - Night Moves (1976) album review". ^ a b c d Erlewine, Stephen Thomas (2010).Jim Bruzzese – recording engineer, mixing engineer.Punch Andrews – production (tracks 1, 3, 4, 9).The album was released by Capitol Records on October 22, 1976. Laurel Ward – backing vocals on "Night Moves" (track 2) Night Moves is the ninth studio album by American rock singer-songwriter Bob Seger, and his first studio album to credit the Silver Bullet Band.Rhonda Silver – backing vocals on "Night Moves" (track 2).Sharon Lee Williams – backing vocals on "Night Moves" (track 2).Doug Riley – piano, organ on "Night Moves" (track 2).Joe Miquelon – guitar on "Night Moves" (track 2).Jerry Luck – accordion on "Ship of Fools" (track 8).Roger Hawkins – drums, tambourine, maracas, congas, timpani, production (tracks 5, 6, 7, 8).David Hood – bass, production (tracks 5, 6, 7, 8).Barry Beckett – piano, organ, ARP synthesizer, clavinet, melodica, production (tracks 5, 6, 7, 8) Heath Sanders covers Bob Segers 'Night Moves' as part of his Live From The Lounge series.Get to know Heath: Facebook.Jimmy Johnson – rhythm guitar, production (tracks 5, 6, 7, 8).Pete Carr – lead guitar, rhythm guitar, acoustic guitar, production (tracks 5, 6, 7, 8).Charlie Allen Martin – drums, tambourine, maracas (tracks 1, 2, 3, 4, 9) background vocals on "Mary Lou" (track 9).Chris Campbell – bass (tracks 1, 2, 3, 4, 9) background vocals on "Mary Lou" (track 9).Alto Reed – tenor saxophone, alto saxophone, baritone saxophone, flute (tracks 1, 3, 4, 9).Robyn Robbins – piano, organ (tracks 1, 3, 4, 9).Drew Abbott – guitar (tracks 1, 3, 4, 8, 9) background vocals on "Mary Lou" (track 9).Ĭash Box said that "'Ship of Fools' might turn into a classic rocker." Ĭlassic Rock History critic Janey Roberts ranked 4 songs from Night Moves among Seger's 20 greatest – the three singles plus "Come to Poppa". Erlewine also feels that the album has a wide range of styles and has not lost any of its influence years later. A later review of the album by Stephen Thomas Erlewine for AllMusic says that the album was very similar to Beautiful Loser (1975), but Night Moves is harder than Beautiful Loser. The only problem that Rachlis had with the album was the production not being strong enough. The Rolling Stone review of the album by Kit Rachlis stated that the album is one of the best to come out of 1976–77, that Seger sounds like Rod Stewart and writes lyrics like Bruce Springsteen, and that the album is classic rock and roll. Village Voice critic Robert Christgau wrote that the riffs on Night Moves are classic rock and roll riffs, like those performed by Chuck Berry or the Rolling Stones, and that the album is about rock and roll for those who are no longer in their teens, like the song "Rock and Roll Never Forgets". Reception Professional ratings Review scores It later achieved a certification of sextuple platinum. ![]() The album became Seger's second to become certified gold by the Recording Industry Association of America and was his first to be certified platinum by the same association. Three singles were released from the album two of them made the top 40 on the Billboard Hot 100. The album was well received by critics, and brought Bob Seger nationwide success. Although the front cover only credits backing by the Silver Bullet Band, four of the nine songs on the album feature backing by the Muscle Shoals Rhythm Section. ![]() We all had that first experience we will never forget.Night Moves is the ninth studio album by American rock singer-songwriter Bob Seger, and his first studio album to credit the Silver Bullet Band. While "Night Moves," is a very personal song for Seger, it is one plenty of people, men and women alike, can relate to. Most of Bob Seger’s songs reveal a touch of nostalgia. ![]() Those cards were under valued as they were not needed for a ton of fodder SBCs, and now they are needed. I expect that to change eventually, but because certain high-rated cards were very cheap in comparison to their overall rating, this is more the course correction of the SBC than anything else. So far, the inflation seems to be happening to the 89+ overall cards who would go into the three 89-rated squads you need for this SBC. With these challenges, what we will need to watch are the prices of 86+ overall cards. ![]() So, if anything, what this Messi SBC has done so far is make his standard gold card way cheaper and more appealing to those who want any Messi. His in-form is at 1.6 million and his base card is 1.2 million. Like (98) Dislike (31) Lionel Messi 91 91. Lionel Messi EA FC FIFA 23 Career Mode Valoraciones Argentina. Again, that seems to be in line with things. FIFA 20 94 / 94 - 30 de Enero de 2020 94 / 94 - 2 de Diciembre de 2019 94 / 94 - 20 de Agosto de 2019 94 / 94 - 2 de Agosto de 2019. His Team of the Group Stage card is up to 2.4-2.5 million coins, which has the +1 pace, defense and physical. The other factor is the other Messi cards. If prices start to go up, then this could change the equation. Lionel Messi - FIFA 22 - 93 rating, prices, reviews, comments and more. His current price on FUT is 47,500 on PlayStation, 0 on Xbox, and 0 on PC. He also received 0 yellow cards and 0 red cards. ![]() His real-life stats are currently 1 goals and 2 assists in 4 matches in domestic competition. Now, that could change somewhat because you need to do 7 separate challenges to get this SBC. He was born on 24-06-1987 and he is now 36 years old. That is close to fair value for this card. Lionel Messis card is rated 97, he is 170cm 57' tall, left-footed Argentina midfielder (CAM) that plays for FC Barcelona in LaLiga Santander with Med/Low work rates. As of now, the SBC costs about 2.2 million coins, according to FUTBin. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |